Phoenix L.

Primary tabs

EOL Text

Eulithis prunata:

The Phoenix (Eulithis prunata) is a moth of the genus Eulithis in the family Geometridae.


Museum specimen



Description[edit]

The moth has a wingspan from about 28 to 37 mm. The ground colour of the forewing is dark brown. The midfield is bordered by grey-white or brown-white cross bands on both sides and shows a strong point-shaped bulge outward. On the distal white wavy line, there are several black arrow stains contrasted white. Below the apex there is a large, dark, crescent-shaped spot located. Three bright wavy lines are visible on the grey rear wings.

Distribution[edit]

Palearctic

Subspecies[edit]

Biology[edit]

Larval Food Plants[edit]

The larvae feed on Currant bushes of the genus Ribes, including Alpine Currant, Blackcurrant, Gooseberry, Redcurrant and R.aureum. Ornamental member of the genus may also be hosts.[1]

Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Eulithis_prunata&oldid=643119659

Description:

Dioecious trees. Leaves pinnate; leaflets numerous, the lower ones often modified to sharp spines.

Licensehttp://creativecommons.org/licenses/by-nc/3.0/
Rights holder/AuthorMark Hyde, Bart Wursten, Petra Ballings, Flora of Zimbabwe
Sourcehttp://www.zimbabweflora.co.zw/speciesdata/genus.php?genus_id=294

IDnature guides:

Identification key for tree genera of Madagascar

Licensehttp://creativecommons.org/licenses/by-nc-sa/3.0/
Rights holder/AuthorJohn Pickering, Discover Life
Sourcehttp://www.discoverlife.org/mp/20q?search=Phoenix

Statistics of barcoding coverage:

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:110
Specimens with Sequences:139
Specimens with Barcodes:129
Species:7
Species With Barcodes:6
Public Records:44
Public Species:5
Public BINs:0

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=210485

Barcode data:

Access Published & Released Data: Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=210485

Phoenix (plant):
Metamorphosed leaflets into spines, common to Phoenix
Phoenix foliage showing V-shaped leaflets

Phoenix is a genus of 14 species of palms, native to the Canary Islands east across northern and central Africa, the extreme southeast of Europe (Crete), and southern Asia from Turkey east to southern China and Malaysia.[3] The diverse habitats they occupy include swamps, deserts, and mangrove sea coasts. Most Phoenix species originate in semiarid regions, but usually occur near high groundwater levels, rivers, or springs. The genus is unusual among members of the subfamily Coryphoideae, with it and Arenga being the only ones with pinnate, rather than palmate leaves.[4] The generic name derives from φοῖνιξ (phoinix) or φοίνικος (phoinikos), the Greek word for the date palm used by Theophrastus and Pliny the Elder. It most likely referred to the Phoenicians; Phoenix, the son of Amyntor and Cleobule in Homer's Iliad; or the phoenix, the sacred bird of Ancient Egypt.[5] The palms were more numerous and widespread in the past than they are at present.



Description[edit]

This genus is mostly medium to robust in size, but also includes a few dwarf species; trunks are solitary in four species, suckering and clumped in nine, of which one has a prostrate ground trunk. Many of the trunked species do not form above-ground stems for several years. The pinnate leaves, 1–6 m long, all share the common feature of metamorphosed lower-leaf segments into long, vicious spines (acanthophylls). The leaves have short or absent petioles and possess the rare feature among pinnate palms of induplicate (V-shaped) leaflets. The plants are dioecious, with male and female flowers on separate plants; pollination is by both wind and insect. The flowers are inconspicuous yellowish-brown and about 1 cm wide, but grouped on conspicuous large multibranched panicles 30–90 cm long. The inflorescence emerges from a usually boat-shaped, leathery bract, forming large, pendent clusters. Phoenix fruit develops from one carpel as a drupe, 1–7 cm long, yellow to red-brown or dark purple when mature, with one elongated, deeply grooved seed.

Ecology[edit]

A majority of the forest palms grow under the shade of dominating forests trees along fragile hill slopes and stream courses in warm, humid conditions. The palms are found growing on a wide variety of soils, often extending to degraded forest margins in grasslands. In the tropics, most are found below 1250 m altitude. Branching of the aerial trunk is rare and is mainly induced by injury to the terminal growing bud. Flowering and fruit are regular and annual. The reproduction is by seeds and by vegetative multiplication. Many species of Phoenix produce vegetative offshoots called bulbils from basal portions of their stems which, on rooting, develop new saplings. Close relationship among the 14 species is illustrated by the ease of hybridisation and cross-pollination. [6] Several natural hybrids were hence obtained: P. dactylifera X. P. sylvestris (India), P. dactylifera × P. canariensis (Morocco, Algeria and Israel), and P. dactylifera × P. reclinata (Senegal). Phoenix species are used as food plants by the larvae of some Lepidoptera species, including Paysandisia archon and the Batrachedra species B. amydraula (recorded on P. dactylifera), B. arenosella and B. isochtha (feeds exclusively on Phoenix spp.).

Uses[edit]

The fruit of P. dactylifera, the date of commerce, is large with a thick layer of fruit pulp, edible, very sweet and rich in sugar; the other species have only a thin layer of fruit pulp. The central soft part of the stem of P. rupicola, P. acaulis, and P. humilis is a rich source of starch. Palms are felled to extract this central ‘pith’ which is dried, powdered, stored and used for preparation of bread by Indian natives.[7] The P. canariensis sap is cooked to a sweet, thick syrup. P. sylvestris Roxb. is widely used in India as a source of sugar. The sugary sap from some African palms yields country liquor on fermentation (palm wine).

While P. dactylifera is grown for its edible dates, the Canary Island date palm (P. canariensis) and pygmy date palm (P. roebelenii) are widely grown as ornamental plants, but their dates are used as food for livestock and poultry. The Canary Island date palm differs from the date palm in having a stouter trunk, more leaves to the crown, more closely spaced leaflets, and deep green rather than grey-green leaves. The fruit of P. canariensis is edible, but rarely eaten by humans because of their small size and thin flesh.

The different species of the genus frequently hybridise where they grow in proximity. This can be a problem when planting P. canariensis as an ornamental plant, as the hybrid palms are aesthetically inferior and do not match the pure-bred plants when planted in avenues, etc.

Species[edit]

  1. Phoenix acaulis Roxb. – dwarf date palm - Himalayas
  2. Phoenix andamanensis S.C.Barrow - Andaman Islands
  3. Phoenix atlantica A.Chev., Cape Verde palm, endemic to the Cape Verde Islands, erroneously characterized as a feral P. dactylifera[8][9]
  4. Phoenix caespitosa Chiov. - Djibouti, Somalia, Saudi Arabia, Yemen, Oman
  5. Phoenix canariensis Chabaud – Canary Island date palm - native to Canary Islands, naturalized in Spain, Italy, Australia, Bermuda
  6. Phoenix dactylifera L. – date palm - probably native to southwestern Asia, naturalized in Spain, Azores, Madeira, northern and western Africa, Mauritius, Réunion, China, India, Australia, Fiji, New Caledonia, California, Baja California, El Salvador, Caribbean
  7. Phoenix loureiroi Kunth (syn. P. humilis) - China, India, Himalayas, Indochina, Philippines
  8. Phoenix paludosa Roxb. – mangrove date palm - Indian Subcontinent, Indochina, Sumatra, Andaman & Nicobar Islands
  9. Phoenix pusilla Gaertn. – Ceylon date palm - India, Sri Lanka
  10. Phoenix reclinata Jacq. – Senegal date palm - Africa, Comoros, Madagascar, Arabian Peninsula
  11. Phoenix roebelenii O'Brien – pygmy date palm - Yunnan, Indochina
  12. Phoenix rupicola T.Anderson – cliff date palm - Assam, Bhutan, Arunachal Pradesh, naturalized in Andaman Islands and West Indies
  13. Phoenix sylvestris (L.) Roxb. – Indian date palm - Indian Subcontinent, Myanma,; naturalized in southern China and the West Indies
  14. Phoenix theophrasti Greuter – Cretan date palm[10] - Turkey, Greek Islands

View of an oasis-like area, in central western Boa Vista, Cape Verde islands, with Tamareiras

References[edit]

Wikimedia Commons has media related to Phoenix.
Wikispecies has information related to: Phoenix
  1. ^ Linnaeus, Species Plantarum 1188. 1753. Type:P. dactylifera
  2. ^ "Phoenix L.". Germplasm Resources Information Network. United States Department of Agriculture. 2004-10-15. Retrieved 2010-07-15. 
  3. ^ a b Kew World Checklist of Selected Plant Families
  4. ^ Riffle, Robert L. and Craft, Paul (2003) An Encyclopedia of Cultivated Palms. Portland: Timber Press. ISBN 0-88192-558-6 / ISBN 978-0-88192-558-6
  5. ^ Quattrocchi, Umberto (2000). CRC World Dictionary of Plant Names. III M-Q. CRC Press. p. 2046. ISBN 978-0-8493-2677-6. 
  6. ^ Moore, 1963; Munier, 1973
  7. ^ http://www.ias.ac.in/currsci/jun252004/1598.pdf
  8. ^ http://www.palms.org/palmsjournal/2003/capeverde.htm
  9. ^ http://www.springerlink.com/content/thg341r405n28455/
  10. ^ "Species Records of Phoenix". Germplasm Resources Information Network. United States Department of Agriculture. Retrieved 2010-07-15. 
Licensehttp://creativecommons.org/licenses/by-sa/3.0/
Rights holder/AuthorWikipedia
Sourcehttp://en.wikipedia.org/w/index.php?title=Phoenix_(plant)&oldid=647129543

Barcode data: Eulithis prunata:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCTGGTATAATTGGCACTTCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTACAACACTATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTTGGAGCCCCTGATATAGCATTTCCCCGAATAAATAATATAAGATTTTGACTATTACCCCCCTCAATTACCCTGTTAATCTCAAGAAGAATTGTAGAAAATGGAGCTGGAACTGGATGAACTGTTTATCCTCCCCTTTCTTCAAATATTGCCCATAGAGGAAGTTCTGTTGATCTCGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCAATTCTAGGGGCAATTAATTTTATCACGACTATTATTAATATGCGTTTAAATAACATATTTTTCGATCAATTACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCTCTACCAGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAACACTTCATTTTTTGACCCTGCAGGTGGTGGAGACCCCATTTTATACCAACACTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=34881

Statistics of barcoding coverage: Eulithis prunata:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 22
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=34881
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith